Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11710H5
Clone ID IST11710H5
Vector VICTR76
Project tigm

Sequence tag IST11710H5HMF1
Sequence
AGCGCTCGGGGAGAGCAGCATGAGCCAGGCGCCCAGCCTCACTACGGCCCACGCTACCCAAGGAGTTCACCCGATGAGGC
CCAGCCGCAAACACCGCATGCGCACAGGAAACCCAGTGCTAAGTGATGGGTTGTCCCGGGAACCGGAGGCGTGACTCCGC
GTTTCCTCNGTCCANNGGCGGGGCGCACGGGGATTGGCTGGATGAAGCGTGCAGCGATGGGCGGGATGGGGCGGGAGGCG
ATTGGCTGGATGCGCCGATGGGCGGGACGGGCGCGCANAGATTGGCGGGATGCGGCGTGGCGCGGTGAGTGTGCTGCTGA
NCGGGGTTAACGC
Sequence Type genomic DNA
Unitrap ID UNI13715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5778167..5778498 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020471 (Pold2) NM_008894 polymerase (DNA directed), delta 2, regulatory subunit Gene [Source:MGI (curated);Acc:Pold2-001]

 
Come back to gene ENSMUSG00000020471


For any suggestions or comments, please send an email to unitrap@crg.es