Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14850F3
Clone ID IST14850F3
Vector VICTR76
Project tigm

Sequence tag IST14850F3HMR1
Sequence
CTTGAAGCAAAAGGGAGACAGCTGANCGGCTTGGCCCCGCCCACCCATTCTGTTATTCAAAGTGGGTCACAGGGTCTCAG
CTAACCAATCACCTACTCTGAGCTGTGGATCCTTGGCTCCAACAAATGCCCATTTCGATAACCAGATGGCCTCAGAAACC
ACAGCTTGAATCTTTACATTCCTGTANTCNGCCTAGTGTGTCCACCCCTTCCAGTTCCTGGCCGGCTCTGAACTTCCTGG
TGGCCCTCANATTAAATCTCCTTCCTTGAACTACCANAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88365917..88366197 271
NO GENE  


Sequence tag IST14850F3BBF1
Sequence
CAAGTCTTAATAAAGCCTGTAAAACTGAGCAAGTGAGGGGGGCTCCAGAGCTGCTTGGCTCACATGGCCCCCTGGGCATA
CAGGTCCCTGGGCAGAGCTCTGGCCTGGTTGTTANAGGGATGGAGAGAAAAGGTTTANTGTTATCTTTGGGCN
Sequence Type genomic DNA
Unitrap ID UNI9685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88366194..88366345 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es