Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12715E12
Clone ID IST12715E12
Vector VICTR76
Project tigm

Sequence tag IST12715E12BBF1
Sequence
TAGGCACTCGCATTCCACGCCCGGCTCCACGCCAGCGAGCCGGGCTTCTTACCCATTTAAAGTTTGAGAATAGGTTGAGA
TCGTTTCGGCCCCAAGACCTCTAATCNTTCGCTTTACCGGATAAAACTGCGTACGTCGGGAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15519930..15520076 145
 
EST/CDNA Est Name
  CR522214.1 - CK386404.1


Sequence tag IST12715E12HMF2
Sequence
TAGGCACTCGCATTCCACGCCCGGCTCCNCGCCAGCGAGCCGGGCTTCTTACCCATTTAAANTTTGANAN
Sequence Type genomic DNA
Unitrap ID UNI21593 UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 68851859..68851925 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391272..57391338 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 86025599..86025665 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105115064..105115130 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15520010..15520076 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20821721..20821787 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036591 (Arhgap21) NM_001081364 Rho GTPase activating protein 21 Gene [Source:MGI (curated);Acc:Arhgap21-001]

 
Come back to gene ENSMUSG00000036591


For any suggestions or comments, please send an email to unitrap@crg.es