Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14685G4
Clone ID IST14685G4
Vector VICTR76
Project tigm

Sequence tag IST14685G4HMF2
Sequence
CTAATAAGATGAAGTCAGGACAAAAAGAAAAATAAAGAAGTACACTTTTGAGATTTTTAATTCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 66217927..66217991 65
NO GENE  


Sequence tag IST14685G4BBF1
Sequence
CTTTCTTAACTATTTTCCTTTGTACATAGAGGGAGAAAACTTGTTTTTGAGGCAGTGTCTCACAATGTACCCTTGGCTGG
TCTGAATCTCACTATGTAGTCCAGGTTCCTGCTGCCTATGCCTCCTGAGTCCTAGGATTAAACATGTGCACTCCCGTACC
AACTCGAAGAAAATTTTAATGTATTTTATTTGTGTGGGTATTTTGTGATCTATACACTACATGTGTGCCTATTGCCCAGT
GAGGTCAGAAGAGGGCATTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI5873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11473822..11474085 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040720 (1110037F02Rik) NM_001081183 RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]

 
Come back to gene ENSMUSG00000040720


For any suggestions or comments, please send an email to unitrap@crg.es