Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10037D3
Clone ID IST10037D3
Vector VICTR75
Project tigm

Sequence tag IST10037D3HMF1
Sequence
GTGGGGAGTGATCAGGAGAGTGGGCCAAAGCTGATTAAAGAGCCATCCAGGCCTCAGATATGCTGTTAAAATAGAAGTCA
AGAGCAGCGGGACACATTCAGGAGGCAGGAGCAGGTAGGTCTTTGTGAGTTCAAAGCCAGCCTGGTCTACACAGTGAGTT
CTAAGCCAGCCAGAGATATGTAGAGGCAAAGAAAGAAAAGAAAGTGCTAAGAATACCACAGGCCTGAGTAGAGTTGGTTC
CTTAGTTCTGCGGCAGGTTAATCCACCCACCTCAAACCTCACATCCTCCAACTCAGTTCGCTGGTTCCCCCCATCCTTCT
GCAGGAACACCCTACTCCTAAGATTTGCTTACAAGACACTTGCTTTGTTGTGCAAAATGGATAACAAAGTACGGAGCGGA
GGTTCATGGGGCAGGTGGTATAGGAAGCCACAAAGTCAAGGGGTGTGGTGCTGGCACCTCGCTGTGCTTGTCCAAAGTTG
AACTCAAGGCCACAGTGTGCACCTTCAGGCGTCGCTCTTCCTTTCTTTCTGGATTCCGTGCCCCCTCCTCAAGATCTTGG
GGG
Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118772449..118773010 556
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es