Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST464040
Clone ID OST464040
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST464040
Sequence
GCCCATATCCTAGGGGGGCCTGTGATCAGCCTTCGGGCAGGGGACCCNCTCAACCTCACCTGCCACGCAGACAATGCCAA
GCCTGCGGCTTCCATCATCTGGCTACGTAAAGGAGAGGNCATNAATGGAGCCACCTACGTCCAAGCTCATCTGGAATCCA
CAACCTATGCTTCCCTTTTTTT
Sequence Type mRNA
Unitrap ID UNI16289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 34798534..34800326 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032036 (Kirrel3) NM_026324 kin of IRRE like 3 (Drosophila) Gene [Source:MGI (curated);Acc:Kirrel3-001]

 
Come back to gene ENSMUSG00000032036


For any suggestions or comments, please send an email to unitrap@crg.es