Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12103A9
Clone ID IST12103A9
Vector VICTR76
Project tigm

Sequence tag IST12103A9BBF1
Sequence
GTCCTCAGTCCTTCTATAGGGTTCAGCTCAGTGGCAGAGTGCCTTCCTAGTATGTGCAAGTCCCTTGGCTTATATCCCAA
CAAAGAGAGAGAGCTGTGTCTGCTTTTACTGTGCCATTGAACCAGATGCCTCATCACCATCTATCAGAAAACTGAGGCAG
GGTTGTGAATTGGAGCTTTAACAAGTTCCAGGCTAACTTTAGCTAGCCTATGGTGAGACCCCGTATTCAAATAAGCAAAC
AAAAATTGGATGATTTTTGAAATTGCATTTAATGTANAGTTGANAATAACGTCATATTACGTGAGGGTTTAAGGTATGTG
CACACTGATACTGTTCCCATTAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI27298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7724042..7724390 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]

 
Come back to gene ENSMUSG00000055188


For any suggestions or comments, please send an email to unitrap@crg.es