Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10088B2
Clone ID IST10088B2
Vector VICTR75
Project tigm

Sequence tag IST10088B2BBF1
Sequence
CTACAAATAGAAGTTGGACATATGAAAGTCATCAGACTTCGCTTCCCAGTAGGATGCAGGCCACAGAGCAGATTCTGTGA
TGATAATCAGTGTGAAGGACAGAAGAACGATTTAAAACTGAAGCAGGACATAGTGCTGCATGACTATAAAACTGGAGCCT
GAGACCAATGCAAAAGGAGGACTATGGGCCTGGGTGAGGCGTAAACTTTGTCTCAAAACAAAATGTAACAAAGTAAAATA
AATGAGGGCAAAGTCTTGGTGCCCAGTGAGAAAACCAGAAAACCCAATCAGAGTTTATTAACATAACCAGAGTCCAAGAG
AAAATAAGGCCAACATAACTTGGTTGAAAATAGTGGTCCAAGCCGGGCGGTGGTGGCACACGCCTTTAATCCCAGCACTT
GGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTATAGAGTGAGTTCCAGGACAGCCAGGGCTACAC
AGAGAAACCCTGTCTCAAAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181275957..181276458 502
NO GENE  


Sequence tag IST10088B2BBR1
Sequence
GTAGCATTTCCATGTAGTTATTATTTTTTTACATTGTAGCTTTTGTTGTTGAGAATTTTCATTCACCGTGAGTATAGTAT
CCTTACATCACTCACATTTCTGTAATGATTTGTGGTATTAAAGCTTTGACGCTGTGAAGTATGACTGCCTGCTGCTGCGG
GTGAGTTGGCTCTCGCCAGCTCCTGCTTCCTGGAGCAGGTCAGGTGCTTTACTCTCAGTCTGTTGTGTCTTCTGGTCTTG
TTTCTTTCCTCATTTTCTTGAAGGACTTCCTCAAATGCTGGTTTTATATGGGACAAACAAGTACTTTTCTCCAACTCCCA
CTGTTGCCTGACACTTGGTTAGTAATAGAATTCTAGGTTCAATTTTTTTCCCCTCAAAATTTAGGACCTACTCAAAGAGC
AGTGATGTGCCAAGGCCCAGGAGCTGCTAATAACTATAGCTCCACCATCTGGGAAATGAGAGAATGTGTAGTTATATAAG
GTCAAGTCCAGTCCAAGAATCTATGTACCATTATAGGCTATCACATAAAAAATAAGCTGATAAATGTTTATAATTACTAC
TCATGAACTCAGCGTGCACAAATGCACG
Sequence Type genomic DNA
Unitrap ID UNI29866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181276455..181277042 586
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000826 (Dnajc5) NM_016775 DnaJ (Hsp40) homolog, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Dnajc5-001]

 
Come back to gene ENSMUSG00000000826


For any suggestions or comments, please send an email to unitrap@crg.es