Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14571B4
Clone ID IST14571B4
Vector VICTR74
Project tigm

Sequence tag IST14571B4BBF2
Sequence
CACCCGAGTCCTAAAACCTATAGAAGAGAGGAATGCAGCATTGAGAGCATGTGTAATCACAGGGCGCCTGATGGAGAGCT
GGAGATGAGAGAATCTCTACAAGCGGGGCGCCAGCCACTGTCTCCAGCAACGTGGAAAGACAACAACTGACCCCCTACGG
CTCTCCTCTGACCAAAAGAAAAGCTAGGAGGGCTCAGCAGGCAGGGCGTGGTGGCAATGCCTGATTCAAGCACTTGGGAG
CCAGGCACGTGGATCTCTGAGTTCAAGGCCAGCCATGGCTACAGAGTTCCAGGATGACCAGGGCAACCTANAGAATCCAT
ATCTCAAAAAACAAAACAAAAAAAACAACCTCCTCCCCTCAAAGANGCAAAAACTAACTTGTGAAAGCTGTTTATCACAG
CGTCCAGCNCACCACACACATGCATGTGCACACACACACACCAAAACTTTTCTCTCTTCCTTCCTTCCCCCCCAACCNNG
CTTCTCTCTTTTCTGANACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173343628..173344125 483
 
EST/CDNA Est Name
  BM938269.1


Sequence tag IST14571B4HMR1
Sequence
GTGTTACCTTCATTCCGAGTGAGACTTCCATTGCGAGTGCTGTTTGAGCCNATCTCCCAGTTTTGTTTTATTTTATTTTG
AGACAAGTTCTTGTAGCCCAGCCTAGCGTGACACTAGCTTTGCACCCCAGGATGGCCTTGAACTCCTAAGTATTGGTATT
ACGGGCATGANCAAGCACACTTGGTCCTTTTTCTCCTCAAACTCGCACCGTTCCTGTCTCCTTCCCCTGAGTGTTAGGCT
CCCAGGAGTGANCCTCCNTGTCCCGTGAAGAGTTGCTTCTTCN
Sequence Type genomic DNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173344123..173344404 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]


Sequence tag IST14571B4HMF3
Sequence
GTTTCACATATATTTTCATTTTTTTCTTCTAATGTTTGAAAACAAAACAAAAATCAACAACCCCTTCTGGTGTCTCTTGG
AGGAAAACAAGGCAGGAGGGTCACTGGAACTGAAGCAGGCTCCAGAGGTGGGGTGTGTGGAATGAGGGAGTGAGTCTTGA
GTGTTGGAATACACGCAGACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35588410..35588647 238
NO GENE  

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es