Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12524B11
Clone ID IST12524B11
Vector VICTR76
Project tigm

Sequence tag IST12524B11BBF1
Sequence
ACTCTANCTCCGGGATGCCGGGCAGCTCCTNANTGAGGACTCCACCCTGGGCTCGCACTCTCCANGCAGGGTCCCCGGTC
CCCTCTGCTCGGACCCTCCCCTCCCCCCGTCCCCTCTGCGCCAACCCTTTCTCCTCCCCCAGGANGCCCTGGTGCACGGA
NCACCCTCTCTTCCTTCACCAGGGAGCTCGCANACTCCACACCTTTGCNCCCTGCACCTATCCTGGAGCGTTTTCCTCCT
CCACTGTCCCGANCTTCCTCCCAGCCCGTGAGCCTCCNCCTCTGGGCANACCGGTAATGGTCCTTCTCGGACCTCGGTGC
TCACTCCTGTCCCCTGGCCTTCCTTTACTCAGACTCATTNNTNTN
Sequence Type genomic DNA
Unitrap ID UNI15829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38781214..38781572 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es