Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12112G2
Clone ID IST12112G2
Vector VICTR76
Project tigm

Sequence tag IST12112G2HMF1
Sequence
CTACCACTTTCTGCTAGTTCATCCCATGAAGACCNAAAGCCATTTTTAAATTTACATATCAATTCAGTTCTTTATTCCAG
GCTCCCTTTTGATTATTCTATGAATCTACATACTGGTGGCCCCAGCCCTTTGATTCTTAGGAAACAGCAAGCATAAGTTT
TCTTTTAAGATAGCAAAATCATTTANAGATCTGATTGCCTCANTTACACAAAGACGCTAAACTANCTGGGTGGGACCCTA
TCCTGAAATTACCNTATGTACCACACCTGGGGCNAACCTTGCCATGTCCCANGCNNACCTTGAACTCANGAATCTGCCTA
TATTTGTATCTGCN
Sequence Type genomic DNA
Unitrap ID UNI31148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41489829..41490161 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]


Sequence tag IST12112G2BBF1
Sequence
CTACCACTTTCTGCTAGTTCATCCCATGAAGACCAAAAGCN
Sequence Type genomic DNA
Unitrap ID UNI31148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41489829..41489868 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]

 
Come back to gene ENSMUSG00000022307


For any suggestions or comments, please send an email to unitrap@crg.es