Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST463943
Clone ID OST463943
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST463943
Sequence
CTGAGATGCTGAGGAATACCAGCCTCCAATATGGAAATCATACTTGTATCAGCTGCAGCAAGAGGCACCTCGTCCCAAGA
GGATCATTTGTCCCCGGGAGGTCCGTACTCAGCTCTCTCCAGTACACCTTGTTAAGTGTGATGAATTGGCAGCTCAGTGG
GCTGATGCTGGAGGGACTTCAGGTTTCCTGGGGGGCAATTTCTATTAACGTTTGGCACAGTGTCACCAAATTGAATATCT
TCATAACTATATACTGAGACCACATGTTAGCTCAATACCTGGTTTTACAATCTGAGAATCAAATGTCTCACATTTTTAAA
CAAATGCAGAGACAAACAAAACTCTTTGTAAATGCCACAAAACAGGTGATAACCTTGTTTTGTGTCACCGTGGTTCCAAC
TGTTTTCAGGATTCTTTATTAGCATATGCTAATTGAATTCAATTATAGGTTTCACTGTGACACTTTATA
Sequence Type mRNA
Unitrap ID UNI16292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54123456..54144444 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004633 (Chn2) NM_023543 chimerin (chimaerin) 2 Gene [Source:MGI (curated);Acc:Chn2-001]

 
Come back to gene ENSMUSG00000004633


For any suggestions or comments, please send an email to unitrap@crg.es