Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14792G5
Clone ID IST14792G5
Vector VICTR76
Project tigm

Sequence tag IST14792G5HMF1
Sequence
AAATCATCTGTCCTGACAGCTAGGTAAGAGCAGAAAAGTCTACAGGCAAACACAGCTTTTGACCCTGTAGCAGCAGAGCA
ATGGCACTCCCAAGAGAGGCCTGCTATGGACCAAGCAGAGTCCACTCAAGGCTGCAAAGCTGTACCCATGCTTGGAAACC
AGAGCCTCAGGGAAGCTGCCCTTCAGCCTGTACGACTTTAGACATCCCCGCTTCTCCGAAGGAACAAGCTGATCAGGGAT
GAAATGGTATGCAAAGCAACATTANTTTTTCAGGGAAAAGACAANAAAAGGATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122616186..122616479 290
 
EST/CDNA Est Name
  AI606766.1


Sequence tag IST14792G5HMR1
Sequence
NTTTATGACCGAGCCTGCNNTTGNACAAAATTTAAGCTAGTGAGATCAGTCAGATTTAGGATTCTGCTAAAAGCAAATCT
GTTC
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122616478..122616559 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]


Sequence tag IST14792G5BBF1
Sequence
AAATNNNNNGTCCTGACAGCTANGTAAGAGCAGAAAAGTCTACAGGCAAACACAGCTTTTGACCCTGTAGCAGCAGAGCA
ATGGCACTCCCAAGAGAGGCCTGCTATGGACCAAGCAGAGTCCACTCAAGGCTGCAAAGCTGTACCCATGCTTGGAAACC
AGAGCCTCAGGGAAGCTGCCCTTCAGCCTGTACGACTTTAGACATCCCCGCTTCTCCGAAGGAACAAGCTGATCAGGGAT
GAAATGGTATGCAAAGCAACATTAGTTTTTCAGGGAAAAGACAAGAAAAGGATGGGCCCTCAAAGCAGGAAAAAACATTA
TGAGATAGGACAGGGAGCCAGCAAGGAATGGACCCCTCTGANCAGCTTCAGTCCCCCCCAAATATAACTGGGCTGTAAGA
NAAAAGANGTGGCCNCTGGNAATTGACATCGGGTGTACTCTCGTCTTTTTTTTTCTATTTCATTCTTTGGCTACACTAGG
ATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122615997..122616470 462
 
EST/CDNA Est Name
  BE946711.1 - AI606766.1

 
Come back to gene BE946711.1 - AI606766.1


For any suggestions or comments, please send an email to unitrap@crg.es