Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14781D6
Clone ID IST14781D6
Vector VICTR76
Project tigm

Sequence tag IST14781D6HMF1
Sequence
GGGACAGAGGAAGAGAGGCAGAAAACCACCTTTGGGTTCCCTCTCAAACGAAACACATTCTGACATACCATCTCCTTTAG
AAAAGATCACTGCCCAGCAACCAAATCTCACCAAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138528106..138528222 117
NO GENE  


Sequence tag IST14781D6HMR1
Sequence
TCCCTACTCCACTGCTAATAAGAATACTGGAAACGATTCAGGGATGAGTGACTTATTTACAGGGGACATAATTCATTTGT
TCCAGCTCATGCTGCCCTTGTGTTAGTGGATTTCTTCCACTGCTAATCTTTTAAGCAGGCTGAAAATTGTAATGCACAAT
TATATCTCTTGAATTTAATTTTTCTTCTTTTTTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI15165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138528219..138528415 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029729 (Zkscan1) NM_133906 zinc finger with KRAB and SCAN domains 1 Gene [Source:MGI (curated);Acc:Zkscan1-001]

 
Come back to gene ENSMUSG00000029729


For any suggestions or comments, please send an email to unitrap@crg.es