Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10238D1
Clone ID IST10238D1
Vector VICTR76
Project tigm

Sequence tag IST10238D1BBF1
Sequence
TTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI12672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580649..55580718 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030951..18031020 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST10238D1HMF2
Sequence
TTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACTCCCTCTTCT
GGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATAAATAAATAAGTCTTTACAAAAAAAAAAAAAAAAAAAA
AAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20516496..20516661 164
NO GENE  

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es