Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13852D4
Clone ID IST13852D4
Vector VICTR74
Project tigm

Sequence tag IST13852D4HMF2
Sequence
TTTATTTATTTTTCGAGACANGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAAACCAGGCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI23119 UNI35747 UNI35748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 10271437..10271513 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 118797971..118798047 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041992 (Rapgef5) NM_175930 Rap guanine nucleotide exchange factor (GEF) 5 Gene [Source:MGI Symbol;Acc:MGI:2444365]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51622277..51622353 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108242701..108242777 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 48762238..48762314 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 85203981..85204057 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079457 (AC123856.4-204) NM_001081746 predicted gene, EG665378 [Source:RefSeq peptide;Acc:NP_001075215]


Sequence tag IST13852D4BBF1
Sequence
TTTATTTATTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTANACCAGGCTGGCCTCG
AACTCANAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCGGCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51622277..51622424 144
NO GENE  

 
Come back to gene ENSMUSG00000079457


For any suggestions or comments, please send an email to unitrap@crg.es