Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13764B9
Clone ID IST13764B9
Vector VICTR74
Project tigm

Sequence tag IST13764B9HMF1
Sequence
GGAATCTTGGAGAGGGGAGGCTGGGGAAGACTGGGAGGAGAAACTGCAGTTGGGGTGTATATGAGAGGAAAAAACTGAAA
AAAGAGACAGTGACATACATAAAACATGGGAACTTCTTTTTTTATATATATAATTTATTTTTTTTGGANACNGGATCTCT
CTNTGTANTCCNGGCTCTTGTTATGTNTCCCAGGTAAANANCCCGCTCAGGTTGNAAANCNGNANCGGGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13764B9BBF1
Sequence
AAGGAATCTTGGAGAGGGGAGGCTGGGGAAGACTGGGAGGAGAAACTGCAGTTGGGGTGTATATGAGAGGAAAAAACTGA
AAAAAGAGACAGTGACATACATAAAACATGGGAACTTCTTTTTTTATATATATAATTTATTTTTTTTGGAGACNGGATCT
CTCTATGTAGTCCTGGCTCTTGTTATGTATCCCAGGTAAATATCCCGCTCAGGTTGGAAAGCTGGANCGGGGCTGCNANT
NANCAN
Sequence Type genomic DNA
Unitrap ID UNI32088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98399917..98400161 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011960 (Ccnt1) NM_009833 cyclin T1 Gene [Source:MGI Symbol;Acc:MGI:1328363]

 
Come back to gene ENSMUSG00000011960


For any suggestions or comments, please send an email to unitrap@crg.es