Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14459E3
Clone ID IST14459E3
Vector VICTR74
Project tigm

Sequence tag IST14459E3BBF1
Sequence
GTACCATCGTCTTTAAACCATAGTACACTTGGTTTGAACTAAATGGGTGTGGCATCTCTCACTGTTTATGGCTGGTGTTT
TAAGTCTTTTTCTCTTCCTTTATTTTCTTTCCCCCTTCAGTGTGTGCTGTGTGTATTTGTCCAGATGGCTTTCTTTTTCA
GTCTAGGAATATTTTCCTCTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCNTTCCTTTCCNTNCCN
Sequence Type genomic DNA
Unitrap ID UNI32820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64957937..64958173 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024085 (Man2a1) NM_008549 mannosidase 2, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:104669]

 
Come back to gene ENSMUSG00000024085


For any suggestions or comments, please send an email to unitrap@crg.es