Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10756B9
Clone ID IST10756B9
Vector VICTR76
Project tigm

Sequence tag IST10756B9HMF1
Sequence
AAATAAATAAATAAATAAATAAATAAATAAATAAATAAATCTTTAAAAAGAAAACATTAGTACACGTANTACATGTGCTT
TAAAAAATAAAGAAAGAAAGCCAGGCAGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCGGAGGCAGGTGGATT
TCTGAGTTTGAGGTCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACNNANAAACCNTGNNTATAAAAA
AAAAAAAAAAAAAAAAAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91706018..91706274 243
NO GENE  


Sequence tag IST10756B9HMR1
Sequence
NNATTTTATGTATATAAGTACACTGTAGCTGTACAGATGGTTGGGAGCCATCATGTGGTTGCTGGGAATTATACTCATGA
CCTCTTATAGTTCCAGTCTGAATATTTATTATTACATGTAAGTACACTGTANCTGTCTTCAGATATACCAGAAGAGGGCG
TCAGATCTCTTTATGGATGGTTGTGAGCCANTGNNTNNCNGN
Sequence Type genomic DNA
Unitrap ID UNI5541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91706271..91706461 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es