Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15043G5
Clone ID IST15043G5
Vector VICTR78
Project tigm

Sequence tag IST15043G5HMR1
Sequence
GTGTGGAAATGGTTGGGACTTTAAAGATGAAATATTTACTGCAGGCAAAATCTGAAACATTAAATTGTTTTACTTTTAGA
ATAACAAAGGATCCTGGAAAAGTTGGAGAAGATAAAGTACACCCAGTGTCCAGATCAGGAGATTGACAGACCAGGTAAGC
TCTGGGAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI12299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68847673..68847843 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]

 
Come back to gene ENSMUSG00000034317


For any suggestions or comments, please send an email to unitrap@crg.es