Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST463797
Clone ID OST463797
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST463797
Sequence
GAGAGCCAGGAGCAATAACGGAGCGTCTGCGAAGTTTCAGCATGCATGATCTGACAGCTATCCAAGGGGATGAGCCCGTG
GGACACAGACCCTACCAGACTTTGCCAGAAGCAAAGAGGAAAGGCAAACAAGCCACCGAGTCACCAGCCTATGGAATTCC
ACTGAAAGATGGAAGTGAGCAGACAGACGAAGAAGCGGAGGGGCCATTCTCCGATGACGAGATGGTGACTCACAAGGCGC
TGAGGCGATCCCAGAGCATGAAATCTGTCAAGACCATCAAAGGCCGCAAAGAGGTGCGGTATGGCTCACTAAAATATAAA
GTGAAGAAGAGACCGCAAGTGTATTTTTAGTGTCTACACCTTGCCCTTCCCAAGATGAATAAACCGCTAACAGATCAAAT
T
Sequence Type mRNA
Unitrap ID UNI16296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66476427..66484643 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es