Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12067C4
Clone ID IST12067C4
Vector VICTR76
Project tigm

Sequence tag IST12067C4BBF1
Sequence
ACGTAGACAAAGCTAGCGTGGAACTGGTATTAAAAAGTGCACCACCACTCCCGGGCTGGAAGGTGTTCTGAAATGTGATA
ACCCTCCAGGATGAAATCACATTTATTTCGGAGAAAAGGTATGAGCTTGGACAGGGCAGTTGTTGCAATCTGTACTTACA
GACCCATTTCGGTGGTAAGCGTTGCTGAACCTGATAACTCAGTTCTAAGGAGTTGGGTCCGGAATAATTCACGAACCAGG
GTGACTGTTACTCCCCTGANCTATCCAATAAGAAGCACGGATAGTGGAGGGTGGCTCCCTTGCCGCCATATTTGAGTTCC
GGGTAGCTGGAGGGAGGANAGTTGTGCTTGANCTTCCCGGTGCCTGTTCTGCCNANTGCCGCTCANTANGAANAACNCCN
GGATGCNTCANAAGCNNGNNATGGTGAGTGTGCNCTGGACTCTTGGAAAGTGNNNNNNNGGTTCTGACACTGCCANGGCN
NTGCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12067C4HMF1
Sequence
ACGTAGACAAAGCTAGCGTGGAACTGGTATTAAAAAGTGCACCACCACTCCCGGGCTGGAAGGTGTTCTGAAATGTGATA
ACCCTCCAGGATGAAATCACATTTATTTCGGAGAAAAGGTATGAGCTTGGACAGGGCAGTTGTTGCAATCTGTACTTACA
GACCCATTTCGGTGGTAAGCGTTGCTGAACCTGATAACTCAGTTCTAAGGAGTTGGGTCCGGAATAATTCACGAACCAGG
GTGACTGTTACTCCCCTGANCTATCCAATAAGAAGCACGGATAGTGGAGGGTGGCTCCCTTGCCGCCATATTTGAGTTCC
GGGTAGCTGGAGGGAGGAGAGTTGTGCTTGAGCTTCCCGGTGCCTGTTCTGCCGACTGCCGCTCAGTANGAANAACGCCT
GGATGCATCAGAAGCAGGAAATGGTGAGTGTGCCCTGGACTCTTGGAANGTGGGCGGANGGTTCTGACACTGCCACGGCT
TTGCTGTANNGTGGCNCCCGGCTCCCCGACGTGTGCAGCAATTTGAGATGGACTTTGGGANTGCCNTN
Sequence Type genomic DNA
Unitrap ID UNI3513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33102452..33102995 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053600 (Zfp472) NP_694703 zinc finger protein 472 Gene [Source:MGI (curated);Acc:Zfp472-001]

 
Come back to gene ENSMUSG00000053600


For any suggestions or comments, please send an email to unitrap@crg.es