Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14755A7
Clone ID IST14755A7
Vector VICTR76
Project tigm

Sequence tag IST14755A7HMF1
Sequence
CTTTAAAGGCCTTTTAAGTTACATAGTCAAGCTCAATAAACAGTACCACCTCACTGTAAGTCTCCCCAGCACAGCCCCCC
AGGGTGCCTGGACCTAGAGCCAGAGGCTATCATGTACCCAGGTTACATAACGACTGTTGGCTCTGCCCTCTGAAGTGGCT
GTGTGCTGCTGCCTCCTCCCCACGTTTATGAAAGAAAGGATTGTGCTGAGTACAGATTAGCGGTTCCTCCCTAGAAATTT
GTAAAAGATAATCAGTAATTTATTCAGATCAACATCCCCTACACAGAAAATAACGAATTTCAAAGTTAGTAACAAAACNT
TCCGAGTTGATTTGGTCACTACATTTGACCATATNNAGAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73600517..73600895 373
 
EST/CDNA Est Name
  CJ137677.1 - BI652312.1


Sequence tag IST14755A7HMR1
Sequence
AAAGAATCNGCCTCTTGGAGTGGGAGATGAATGTGGGAGGAGTTAAGGGAAGGACTGGGAAGCGAATACGGTCAAAATTA
ATTGTATGCATCTGTGAACTCTTCAAGGACTTGAAGAATTANTCTCATCCTCAGCTCTGCACACAGAAGCAAGAANCATT
TGGAGCTCTAAGTTGTTTCCGAAGTTAGTCTCTGTGTGGAGAAGGCTGTCTCCTCTCAAAGACTTCTGCCAGAGCGCCTA
NNACNCNTGCCTATCGATCTTTTGTCCGTANACCCCTTGAAGGTGGCTCCTGCCGCTAACTGGCNCTCATTGTATAGATT
CNGGGANCTCTGTTGGAGANACNCACTGCTCCTGGCTGGTGGGANNGCNNNANCNNTN
Sequence Type genomic DNA
Unitrap ID UNI10517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73600157..73600520 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es