Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11151H9
Clone ID IST11151H9
Vector VICTR76
Project tigm

Sequence tag IST11151H9HMF1
Sequence
GCGGCTGACCCGGCCTGANCCTCCACGGAGTTCAGGACCTCANCGCGGCCGGGAGCTGCGGGCGAGCCCCTCGTCCCTGC
CCGCCGTGCTGTCGCCGAAGAAACCGGGAACGTTGGGAGGAGGGAGTCCCCCTGGGCCTCCCGCTCGATTCCAGCTCTCC
GCGGATGGTGGGCGGTGTGCGGACTCTGCGCGCTCTGCTTGGGCGCTCCTGTTTTCCCCGGAGTGGGATCCTACTTTTCC
CAAACTTAACGAGTTTATCNAAGTTCANTGACNNTNTNCCTNNNTGTATCCCCCCCCCNTGCCCCNNAGGGCAACTGGAA
GGTCATTGTTTGTTCNAGGGGGCGGATGTNANTTTTGGGGCGTNGNANCNNCCNACATCATANGGCCGGNCACCTGGGAN
NNACTCTTTGNGCCTNGGNNCNGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11151H9BBF1
Sequence
GCGGCTGACCCGGCCTGAGCCTCCACGGNGTTCAGGACCTCANCGCGGCCGGGAGCTGCGGGCGAGCCCCTCGTCCCTGC
CCGCCGTGCTGTCGCCGAAGAAACCGGGAACGTTGGGAGGAGGGAGTCCCCCTGGGCCTCCCGCTCGATTCCAGCTCTCC
GCGGATGGTGGGCGGTGTGCGGACTCTGCGCGCTCTGCTTGGGCGCTCCTGTTTTCCCCGGAGTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168591242..168591471 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es