Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12565G9
Clone ID IST12565G9
Vector VICTR76
Project tigm

Sequence tag IST12565G9BBF1
Sequence
CCATCACTCCAGCTGCTTTAGTTTTGAAAAGATTTACAAAGTGAGCAGAAAGGCTCTTTATGATCTACTCTCACCGAGAG
ACAAAACCAGAACAAAGCAAAACAAACAAACAAACAAACAAAAAACCAAGCCCATAATATAATAATTTTGCTCTTTGTTT
TGTGTGTGTGTGTGTGTGGGGGGGGGGGGGT
Sequence Type genomic DNA
Unitrap ID UNI35753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46149201..46149390 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066158 (AY512931) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q6R5F1]

 
Come back to gene ENSMUSG00000066158


For any suggestions or comments, please send an email to unitrap@crg.es