Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14204C10
Clone ID IST14204C10
Vector VICTR74
Project tigm

Sequence tag IST14204C10HMR1
Sequence
TTATAGAATCGACTCTGGGATTGTTTGGCCCANAAACAGTTGTTTCTGCAATACCTTGTACAGCTTGCTAGCAGAGTGAA
CCTGTTGTACAATGGGAGAGAAGGTAGCCTGGGCCCCTGTGGTCTTGTGTTCCTGTATTCCTAGGCCCCTGTGTTACTGT
ATGAGGCACAGGGTTTAAGCTCAAGTTTGCAAACCCCCTTAATTTGTGGAAAGTGCCCTGCCCATGTTTGGAAATCTTCC
ANACTCTGAAGGACTTCTCTCAAANAAAAACCCTGATCTANAATTGGTTCTATAAAACANAANCNACTCTGGGCACCTTC
CCACTCTATGGACGTTCATTAANCATCTGCTATNNCACGCTGTATAGTACAGGGCCTTGGGCTGGAANTCTCANGCTAGT
CCCTACCTCTGCCTTACTCACTGTGTGAGTTCANGTGGCCTTCCATCCCTTCATTTCNCCNATCAAACTGTGANGGATTG
AATAGAGCTTTTTTTCTTTTAAGTCNNCACCNACNTCTCTTTCANTTTNNNCNANNGGG
Sequence Type genomic DNA
Unitrap ID UNI30487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62178834..62179361 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028393 (Alad) NM_008525 aminolevulinate, delta-, dehydratase Gene [Source:MGI (curated);Acc:Alad-001]

 
Come back to gene ENSMUSG00000028393


For any suggestions or comments, please send an email to unitrap@crg.es