Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST463637
Clone ID OST463637
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST463637
Sequence
AGGGCCCCAGGCTCTCCAAGAACCAGAAGTTCTCCGAGCACTTCAGCATCCACTGCTGCCCACCCTTCACCTTCCTCAAC
TCCAAGCGTGAGATCGTGGACCGCAAGTACAGCATCTGCAAGAGCGGTTGCTTTTACCAGAAGAAGGAGGAGGACTGGAT
CTGCTGTGCCTGCCAGAAGACTAGCCGCCGTGCCACGTCCCCTCAGAGGCCCAAGCACCAGCCAGCTGCGTCCCCAGTGG
TGGTCAGAGCGCCGCCAGCCAAGCCAAAGTCCCCTCTGATGCCAGCCAAGCCAAGGTCCCCACCGAGGCCAGCCAAGCCA
AGGTCCCCTTCAAGGACTGAGCGCCAGCCGCGTCCCCGCCCAGAGGTNCGACCACCANCAGNCAAGCAGAAGCCCCNCTC
AGAAGTTCTAAGCAGCACAGC
Sequence Type mRNA
Unitrap ID UNI16301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120076945..120077574 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032517 (Mobp) NM_008614 myelin-associated oligodendrocytic basic protein Gene [Source:MGI Symbol;Acc:MGI:108511]

 
Come back to gene ENSMUSG00000032517


For any suggestions or comments, please send an email to unitrap@crg.es