Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14392H2
Clone ID IST14392H2
Vector VICTR74
Project tigm

Sequence tag IST14392H2BBF1
Sequence
CTGGGGNCNTCGGGAGCACTGGCCTGCGACGCGACACCCCACGCCGCGGCCTGCGAGTAAAGCGCTGACGGGAGCTACGG
AAGCGGCGCCCGGATCGCCCCACTCCCTCCCTCAGCGCACTCCCCGACCCGGGGGGAAAGGAGGAAACCCACTTCCGCCG
CGTCCACGATCTCCCGCGGCTTCTCCTGACCCTTACGGCTGGCGTTGGTGCTGGGCATCAGGACACTGGATTTGGGGAGT
GGATACCACCCTCCCTCGCAGGCTTCCGTAGGACAGGCTAAGAAGCGGCTCCCTCCCGCACAGTCTCGCCCTCCCAGCCC
GGGTTCTAAGCCCCCAGTCTCCGCGTGGAACCTTGGCTTCGGAAATATCGCGAGAGCNNCAGCGAGCTCTCGCGCGCCGC
CGCCAGCTCCTCCCTCTGCCNNGCCCACNGGAGTCATGGGGCGTGGCNCAGAAGTGGGTGTGGTCTNGCAGGATANGCTC
CNANGAATCTTCCCTGCNCAGCCTCTTGNNNTACCTACNNNCNTGNNCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130313577..130314094 484


Sequence tag IST14392H2HMR1
Sequence
CCNGGGGCCGTGCCTGGGCTCGCGGCCTCAACTACTCGGGACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130313535..130313580 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]


Sequence tag IST14392H2HMF1
Sequence
CTGGGGTCCTCGGGAGCACTGGCCTGCGACGCGACACCCCACGCCGCGGCCTGCGAGTAAAGCGCTGACGGGAGCTACGG
AAGCGGCGCCCGGATCGCCCCACTCCCTCCCTNANCGCACTCCCCGACCCGGGGGGAAAGGAGGAAACCCACTTCCGCCG
CGTCCACGATCTCCCGCGGCTTCTCCTGACCCTTACGGCTGGCGTTGGTGCTGGGCATCAGGACACTGGATTTGGGGAGT
GGATACCNCCCNCCCTCNNNGGCTTCCNTANGACAGGCNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130313577..130313857 261

 
Come back to gene Mm.28693


For any suggestions or comments, please send an email to unitrap@crg.es