Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0533
Clone ID BC0533
Vector pGT2lxr
Project sanger

Sequence tag BC0533
Sequence
CTTCTCTATCCTCATTTCTTTATTATCCTTGATCCTTCGCGTCCTTTCTTCTTTGTATCAGCATGTTCGAGCTCACTCCT
CTCCAGCCTCCCTGCAGCTGGGTGCCGTTTCTCCTGGGACACTCACAGCCAGTGGCGTTGTCTCTGGCCCTGCCGCTGCC
CCTGCAGCTCAGCATCTCCGGCAGTCCTCCTTTGAGATCCCTGATGATGTACCACTGCCAGCAGGCTGGGAGATGGCCAA
GACATCTTCTGGTCAAAGATACTTCTTAAA
Sequence Type mRNA
Unitrap ID UNI581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8001457..8001668 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]

 
Come back to gene ENSMUSG00000053110


For any suggestions or comments, please send an email to unitrap@crg.es