Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13731G12
Clone ID IST13731G12
Vector VICTR74
Project tigm

Sequence tag IST13731G12BBF1
Sequence
ACCCTATCTTCAATAAAAACAAAGTTGGAGCTATGGAGGTGGCCAAAAGATGGTAGCAGGTCCCCTGGAACTGGAGTTAC
AGGTAGTTGTGAGCCACCATGTANATTCTGAGAATCAAACCCAAGACCTCAGGAAGAATAGGCAGTGCTCTTAACCACTG
AGCCATTTTTCCAGCTCCTGGCCCCCACTGCTAAGTTGGTTTTGGTTTTGTTTGTTTGTTTGTTTGTTTTTTCTCAGTAA
ATGAATGTGCANANAGCGTCTGAAGAACTTGAAGCATTTCGCTACTACCTGTTGAGGGGGTTGATAAATATTTACTGANT
GAATATTTTGCANGCACTCTGGGTTNANANAANNNGCNGGANACANANANCCNGGATTTATNCNTTGTANTTTGNANTTG
CNNGNNNNNACAGTGTGCTACAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13731G12HMF1
Sequence
ACCCTATCTTCAATAAAAACAAAGTTGGAGCTATGGAGGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI19062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7820483..7820527 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es