Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST463459
Clone ID OST463459
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST463459
Sequence
CCACGGTGATCCTGAGGCCCTTCCTACGATGAGAAGCGGGGTGCCTGCAGCGTTGGGGCCAATGTCAGGGATGCTGCCTG
TTATGTGTGCTGGGCTTTTGCACGTGCCTATGAACCTCAGGAGTTGACACCTTTTGTGACTGCCATTTCAAGTGCCCTGG
TCATTGCCTGCTGTATTTGACCGAAATGTGAACCTGCAGAAGAGCAGCCTCTGCTGCCTTCCANGANAACGTGGGGAGAC
AGGGTACATTTCCNTCATGGAATTGATATTTTGACTACAGCANACTATTTNGCAGTTGGNAACATATCTAACTGTTTCCT
GATTATAAGGNANGNNNTAACGCGTGNAACATAACTGNCTCTNTGACTTGNANGANAAAANTCNCCTTCAATANTTCCTT
CATTATCCTGCGCNCTGTATATGACTTATGCTGTAGAGAGGGAATTGNGCTGAGAACANCTTCTTGAACCCGTCCTCATA
CCAAG
Sequence Type mRNA
Unitrap ID UNI16309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121402170..121422229 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]

 
Come back to gene ENSMUSG00000039230


For any suggestions or comments, please send an email to unitrap@crg.es