Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST463454
Clone ID OST463454
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST463454
Sequence
ATGTCGCATTTTCTACGACATGAAAGTTCGGAAATGCTCCACACCAGGAAGAAATCAAGAAAAGAAA
Sequence Type mRNA
Unitrap ID UNI672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143764150..143764215 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es