Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10030G7
Clone ID IST10030G7
Vector VICTR75
Project tigm

Sequence tag IST10030G7BBF1
Sequence
TAACAACTTAAAGCAAAGGCATTGGAGCTTTCCAACACAAAATAATCGGCTTAAAGAGCACTGTGGAGAAAAGTCCAATA
TTGGGCTGTTGGCTGGGAAGAGTGAGGGAAGACAGAGAGAAAAACAGATTTTTTTTTAGATGGGAACTATTTTTGGGATA
TTAAAAATAAAAAATAAAAAGTACAGTGAGAAGAGCTAAGGCCCAGGGAAAGCTGAAAAGACGGCTCACAGGAACGGCCA
GGGCCCAGACTGTGGGGAGGGCTGAGAAAGGGGCCAGAGAGAGCAGAGATGTCCAGGGTGTGGGCAAGGTAGCGGATCGG
ACAGCAGTTTCCACCGGAAGTCAAAGGGTGCAGGTGGAACCCAAGCAGGAAGGGAAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104608189..104608570 382
 
EST/CDNA Est Name
  AI117733.1 - CD560094.1 - CN674808.1 - BY059629.1 - CN680354.1 - CF908865.1 - CN677888.1 - CN667734.1 - CD544791.1 - BG087582.2 - CF166350.1 - CD548514.1 - BY072970.1 - CN666987.1 - BY261377.1 - CJ173908.1 - CF164016.1 - CD548247.1 - BY020597.1 - BY040685


Sequence tag IST10030G7HMR1
Sequence
GTTAAAGATTCCTANNNCCCTAGCCNGAGTCTCTGCCATGAGTCCCATCCTGCCTCGAAGCAGGGCTGCTGTGTCCCTTC
ATAAAGCAGCCCTCGGGCCTTCCCCAGCATCGTCTCCACAGCCACCCTGCCTTCCCTCACTTCCCAGTATCCTCTGCTTC
TGGCAGCTATGGGACCCCTGCCCCTGGCTTCTCCTCCATGCTGTATGGAATGAAGATCGCAAATCTGGCCTTCGTCACCA
AGACTCGGGTCAGGTTCTTCAAACTANACCGCTGGGCTGATGTGCAGTTACCAGAAAAGAGGCGAATAAAGCCAGGGTCG
AACATCAGCAAACAACACAGATCACTGTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI13516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104607839..104608192 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es