Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14782F6
Clone ID IST14782F6
Vector VICTR76
Project tigm

Sequence tag IST14782F6HMR1
Sequence
GTATGAATTCTGTTTTGTCTGCAAGTGGTATATAAACCTGTGCATGCATTTCAAGGTGTAACGGCACCTCTGTGCCTATG
TCCACCTTCAGAAATAGGATGTAGTGTGTAAGGCTAGCTACGT
Sequence Type genomic DNA
Unitrap ID UNI30536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81059469..81059591 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]


Sequence tag IST14782F6HMF1
Sequence
ATACTGTGAAAGACAAAGAGAATAGCTAGGCCCATCCGCAGATACTGGAAACCAAAAGGCGGATAGACTAAGGCCAAAAA
AAATTTAAGCTCACTACTGTAATAACCCAGGCAGTACTCATGCAACTGATACACACAATTTATCTTGGGGATATGGGGGA
GGAATGATAAGCCGATCTAAGCAGCCTGCCTACAANAGTCCTTTAAAGGTGGAGGGACCTGCTACAGTGATTCTGATACC
AAGCACAGCATTAAATACAGGGAAGGGTTCGCACTGTCAAACAGGGTCTGAAGCGCCTTCCTCTGGTCCCTGCCTTGTCC
AGTGGGATTCCTGCTGTCTTTTCTGTCTTCNCTCTGCTATTTTCTTTTCCCTTCAGACTTCTGAAGGCANANTGCTTGCT
TCCATTTCTCTCTCACCTCTGCAGCTTCACCCAGCAGTTAGGANCCACATGCTNNAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81059015..81059472 444
NO GENE  

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es