Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11695C11
Clone ID IST11695C11
Vector VICTR76
Project tigm

Sequence tag IST11695C11HMR1
Sequence
GTGCATGCCTTTAATCCCAGCACTCAGGAGCCAGAGACAGGCGGATCTCTGCCAGCCTGGTCTACAGAGCGAGGTCAGCC
AGAGCTGCNCAGAGAAACCCTGGGTGGGGGTGGGGGTGGGGNGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30923578..30923698 119
NO GENE  


Sequence tag IST11695C11HMF1
Sequence
GCACCACACCGCTAGCTTGTGGTACAGCTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNNNT
N
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30923506..30923581 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es