Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14937D4
Clone ID IST14937D4
Vector VICTR76
Project tigm

Sequence tag IST14937D4HMF1
Sequence
CAAGTTATGTATTCTTTCCCTAAGTCATCCTTCCTATATTCACCAACTGCTACTGATGCCAGGCTCCTGGGATTCTTTGA
CAGATGAATCCGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27219533..27219626 94
NO GENE  


Sequence tag IST14937D4HMR1
Sequence
NNCTTGGNTCNTGCCTTTGGGATGTATCCTAGTAAGATTTCTTACAGGAATGACAGGTATTTTGCTTCTTGGTCAAAATG
AAAATTTCAGTAGCAGTTTGTGTTTCTGGACCGTGAGTTTGTCCTGACTGGAATCCAGAGGCTGANAGGCAGAGCTTGCT
GAGCCAGGGTCTCGAGGGAGCCGGTAGTGCTGGTATCTGTCCGTANGGCGGAGGGAGAAACTGAGCAGGCTGTGTTAGGA
AAACAGTCTGGCCTTCGGGGATGATCTANCCTTACTGTTANATATCTGANTCATCCANNANATGAN
Sequence Type genomic DNA
Unitrap ID UNI20735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27219623..27219925 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es