Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14000D9
Clone ID IST14000D9
Vector VICTR74
Project tigm

Sequence tag IST14000D9HMF2
Sequence
AGAGCCTGGGACATTCTTCCACAACAAGCAAAAGTATAGGTTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100251108..100251155 48
NO GENE  


Sequence tag IST14000D9BBF1
Sequence
CAAGTATTGAGTATTCCCAACGAGAAGAGTATGAGGCTACAGGGACACCTTTCCCAGGGGGGGCTGNNTN
Sequence Type genomic DNA
Unitrap ID UNI23137

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35647279..35647344 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024406 (Pou5f1) NM_013633 POU domain, class 5, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101893]

 
Come back to gene ENSMUSG00000024406


For any suggestions or comments, please send an email to unitrap@crg.es