Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST463223
Clone ID OST463223
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST463223
Sequence
CCCGTGTGGAGATGTCCTATNAAATGACAACACTAATGATGTAGACTCTGGAAATGCCTAATAAGTCAAAGAAGATGTTA
TTAAAGCTTTTTGTTTTCTGCTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16113982..16114086 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047213 (Ythdf3) NM_172677 YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]

 
Come back to gene ENSMUSG00000047213


For any suggestions or comments, please send an email to unitrap@crg.es