Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10805E7
Clone ID IST10805E7
Vector VICTR76
Project tigm

Sequence tag IST10805E7BBF1
Sequence
AAAGTAAACGTTTCCCTCGCAAGCGGCATAAAATAGTGTTTAAACAAATATTGTATTGGCATGCTCCGGGGGCTCGGTGC
CAAAAAAGAAAAGTAAATAAACGGTGAAATCCAAAATATACAGCACGGGGGGGATAGCGGGCAGAATAGGCGGGCTTGTC
ACAAGTCTCCCTGATGTTATCTGTTTGTTCTAGCCNCCTCTCCTTCGAGCCCCCTCCCCGCCCATTTCCTCACCTTGGCT
GCGGTTTCCCTTTTTGAGTAGGCTTCCGTGTGTCTGGGGGACTAGCCCCTTCAATGGCTCAGTTGGTCTGGAATTGGGGA
GGGAATACATTGTGTTCCTACCTGGNNTGGTCTCCCCCAAGTAGGAGGAAACATTCCTGATGCTTACTCGCTTTGAGTTT
TGAGGCTCTTGCTTTCTCCCAGCTTCTGTTCTATCCTGGGCACTAATCCCAGAANGTCTAATCTAAACNNCGCAGANCCC
TCCTGCTAAAGGCTTCACTCCTANNNTCTCTACATCTTGCTTTCCCTTTCTCCNACCAGCTCCTTNTNTNTANNNGGTTC
CNANNNTTN
Sequence Type genomic DNA
Unitrap ID UNI9266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 120947832..120948392 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048402 (Gli2) NM_001081125 GLI-Kruppel family member GLI2 Gene [Source:MGI Symbol;Acc:MGI:95728]

 
Come back to gene ENSMUSG00000048402


For any suggestions or comments, please send an email to unitrap@crg.es