Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10358F10
Clone ID IST10358F10
Vector VICTR76
Project tigm

Sequence tag IST10358F10BBF1
Sequence
GGGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCNAAGGTCCCGAGTTCAAATCCCANCAACCAC
ATGGTGGCTCACAACCATCCATAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI35761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 30149056..30149168 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024817 (Uhrf2) NM_144873 ubiquitin-like, containing PHD and RING finger domains 2 Gene [Source:MGI (curated);Acc:Uhrf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132359444..132359556 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28651457..28651569 109
NO GENE  

 
Come back to gene ENSMUSG00000024817


For any suggestions or comments, please send an email to unitrap@crg.es