Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10926H11
Clone ID IST10926H11
Vector VICTR76
Project tigm

Sequence tag IST10926H11HMF1
Sequence
GAAGGCTGGGGCAGAGTTCTTCAGAAGGCAGTATATGCTTTGAATCAGCGCTCGATATATGGTACAGTTTCACCCATAGC
CAGGATTCATGGGTCCAGGAATCAAGGGGTGGAAAAAGGAATAGTTCCACTTACTATCACTCCTAGTGACCCTCTAGGAA
AATTTTTGCTTCCTGTCCCCATAACTCTAGGTTCTGCTGGCCTAGAAGTTTTGGCTCCAGAGAGGGGAGTGCTCCTACCA
GGAGCTACAACAAACATTTCATTGAACTGGAAGCTCANACTTCCCCCTGGTCATTTTGGGCTTCTAATGCCCTTAAACCA
ACAGGCTAAAAAAGGAATAACAGTGTTAGGAGGGGTGATAGATCCAGATTACCATGGGGAAATTGGATTACCTCTTCACA
ATGGTGGTAAGCAAGATTATGTCTGGAGTGCANGANATCCCTTNNGGCGTCTCTTANTACTACCNTGTCCTGTGATTAAA
GTCAATGGGAAACTACNACAGCCTAATCCAAGCN
Sequence Type genomic DNA
Unitrap ID UNI2131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84971049..84971561 497
 
EST/CDNA Est Name
  CN686268.1 - BB621855.1 - CF167930.1 - CF165343.1 - CJ067845.1 - BY012911.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44023205..44023717 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]


Sequence tag IST10926H11BBF1
Sequence
GAAGGCTGGGGCANAGTTCTTCAGAAGGCANTATATGCTTTGAATCANCGCTCGATATATGGTACAGTTTCACCCATAGC
CAGGATTCATGGGTCCAGGAATCAAGGGGTGGAAAAAGGAATAGTTCCACTTACTATCACTCCTAGTGACCCTCTAGGAA
AATTTTTGCTTCCTGTCCCCATAACTCTAGGTTCTGCTGGCCTAGAAGTTTTGGCTCCNNAGAGGGGAGTGCTCCTACCA
GGAGCTACAACAAACATTTCATTGAACTGGAAGCTCANNCTTCCCCCTGGTCATTTTGGGCTTCTAATGCCCTTAAACCA
ACANGCTANAAAAGGAATAACAGTGTTAGGAGGGGTGATAGATCCNGATTACNNTGGGGAAATTGGATNACCTCTTCACA
ATGGTGGTAANCAAGATTATGTCTGGAGTGCANGNNNTCCCTTANGGCGTCTCTTAGTACTACCATGTCCTGTGATTNAA
GTCAATGGGAAACTACAACAGCCC

Sequence Type genomic DNA
Unitrap ID UNI2131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84971049..84971551 463
 
EST/CDNA Est Name
  CN686268.1 - BB621855.1 - CF167930.1 - CF165343.1 - CJ067845.1 - BY012911.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44023215..44023717 463
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]

 
Come back to gene ENSMUSG00000034342


For any suggestions or comments, please send an email to unitrap@crg.es