Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10051H9
Clone ID IST10051H9
Vector VICTR75
Project tigm

Sequence tag IST10051H9HMF1
Sequence
AAAACAAGTCTCCCTCCCACACCCGCTTATACTGGTAGTGCTGGGCATACAATTCAAGGACTTGTACATGTTAGCTAAGC
GTGAAGAAAAGACTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7816395..7816491 97
NO GENE  


Sequence tag IST10051H9BBR1
Sequence
TTTTCTAGTCTCCCTAGAGCCCGACAGGCAGCAGCTGACATGCACGCCCTAAGCTACAGGGTGCCGTCTTCTGTGGCCTA
ATCCAATGTCTTTACAAACCCTCGTATTCCTGTGCGCCTGCACTTTGGTCTCTGACCACGCCTCTCTCTGTGATGCCCGG
AATGTCTGCACCCCACTCTGTCTAGAGGTGTTCACACTACAATGGTTTAATCCAAGATGATGATTTTCATTCCAATCAAT
GTGACCACAGGAATGTCCACAGCCCAGGCTATCTGACCTCAGGAATGCATGTCTGGAGGGTCCACAGGAAGGGCATTCAA
TCACAGATGCTTCTACGCCCACACCCATTGCCTCAGCAACTCCGCAGTGCCCGGGAAAGAGCTCCACAAGTGTCCCTGTT
CTGGGCTTTGACTCTTAGGAGTTGTATCGGTGGGGCAAGTGATCCAGGCAAAGGAAGGTGAAACCTTGTGCTTGCCCTAT
TCCTGAGCAGCACGCAGAGATGAGGATGGAGCTGGAACAGTCAACCTGAGGACCAGTGGTGCGACATGAGATCAGAGAGG
GCCTATGGCAGGACCACGAAATGCCTGAATGGAACCCAATAT
Sequence Type genomic DNA
Unitrap ID UNI30727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7815796..7816398 583
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es