Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11549E1
Clone ID IST11549E1
Vector VICTR76
Project tigm

Sequence tag IST11549E1HMR1
Sequence
TAGGTACCTACTCCAACNNTACCTCTGCCCCAGCTAACTGCTCCGTGGCCTCCCAACACAAGCTGACCCTGTCCGAAGTA
ACCGGACAGGGACTCTGCGTAGGAGCAGTTCCCAAAACCCATCAGGCCCTGTGTAATACCACCCAGAATACAAGCGACGG
GTCCTACTATCTGGCTGCTCCCGCCGGGACCATTTGGGCTTGCAACACCGGGCTCACTCCCTGCCTATCTACTACTGTAC
TCAACCTCACCACCGATTACTGTGTCCTGGTTGANCTC
Sequence Type genomic DNA
Unitrap ID UNI31865 UNI34902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133546462..133546739 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004552 (Ctse) NM_007799 cathepsin E Gene [Source:MGI (curated);Acc:Ctse-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 22461396..22461673 272
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76369622..76369899 272
 
EST/CDNA Est Name
  BY277916.1 - CJ151787.1 - BY126026.1 - BY275106.1 - BY288495.1 - BY288125.1 - BY276450.1 - BY238741.1 - BY289248.1 - BY289939.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70655103..70655380 272
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 15943575..15943852 272
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24743827..24744104 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038072 (Galnt11) NM_144908 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 Gene [Source:MGI (curated);Acc:Galnt11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 71278758..71279035 272
NO GENE  

 
Come back to gene ENSMUSG00000038072


For any suggestions or comments, please send an email to unitrap@crg.es