Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14906E1
Clone ID IST14906E1
Vector VICTR76
Project tigm

Sequence tag IST14906E1HMR1
Sequence
AGGGTTTCCTCTGAGGACCTCACGAGTGCAATTCATTTCTTCAGTCTTTCTTCCTCAGTATTATCAAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI13974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25156109..25156179 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]


Sequence tag IST14906E1HMF1
Sequence
CCCTCAATTCCTGAGACAGCGTAATTATCTGCTTCTAGCCCATGACCTTTCTTTGCTGGTGACTGGCTGAGTGGGGCTCT
GTGAGGATTGCAGATGCCAGGCAATGGTCTGCACCTAACCAGTTGCTACGGGAATGTAGGTTATCTATAGCACACAGGAG
TGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25155950..25156112 163
NO GENE  

 
Come back to gene ENSMUSG00000037492


For any suggestions or comments, please send an email to unitrap@crg.es