Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14874E7
Clone ID IST14874E7
Vector VICTR76
Project tigm

Sequence tag IST14874E7HMF1
Sequence
AGGGATTACAGGGTGTGCCGTGTCCAAACCCTATAAGCCTTTCTAGTTTTTCTTTTTTAATGAAACGTTTTTAGGTTTAT
TTATGTGATGAGTGTTGTGCTTGTACACGTGTATGTGTAGTACCTGTGTGCCTTGTGCCTGGAAAGGCTGGAAAGGAGCC
TCTGAGTGGAGCTACAGATGGTTGTAAGCTACCATGTGGGTGCTGGGAAGAACACAGGGTCCCCTGAAAGCAGCCATTGC
TCTTCACTGCTGANCCATCTCCTCANTACCCCCTTTTATTTTTTAATTAAAAAACTGTTTTGGTTTGAATATGCANGTGT
GTTATANGTNANGATGGGCATGCNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91718420..91718765 332
 
EST/CDNA Est Name
  W83330.1 - BU694523.1 - BU699926.1 - BU697226.1 - BG087058.2 - BG086261.2 - CF161032.1 - CF156396.1 - BG311006.1 - AA050414.1 - BB856399.1 - BQ127624.1 - CJ166242.1 - CJ130505.1 - BE134487.1 - CB573333.1 - BE655088.1 - BY060686.1 - BY259923.1 - BY062405.1


Sequence tag IST14874E7HMR1
Sequence
CCTGAGTCTGAGATNNGCATTCATGCTACAGTGGGACTTAGATAAACAAGAATGCCCCAGAAGAATGCAGACCACAGTTC
CACCGAGCGCAAGCGCGGCTTGGCTGTCCACTCTTACGTTAATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI22700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91718296..91718422 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]

 
Come back to gene ENSMUSG00000058240


For any suggestions or comments, please send an email to unitrap@crg.es