Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14817D7
Clone ID IST14817D7
Vector VICTR76
Project tigm

Sequence tag IST14817D7HMF1
Sequence
CAGGCAAAGAAGGGCCCTTCTCCTATTTTCTCACCGTGTCTCATGTATCCTAGGCTGACCTCAAGACTCACCCTCAGACT
CACTGTGGACTCCCATCCCCCTTATTTACATTATCCTTGGAGGGAGAGAAAAGGGAGAAGAAGCCCCTTTCCAAGGCCTG
GAAAGTGTTACACATCAGCGTCTTTTAATTCAGGAGCCTGTGTGACCACCTCCCCCACCCCACAGCCTTTCCGGCTGCAT
CTACTCATAACCCAATGTTTAGCATCCACTAAGACACTGTGTATTCAGCATGTCGTCTCTAGTCATCATTCAAAACAGTC
TCTCGTGTCACTCATTTATCTGAGCTGTTGTTGGTACTGTGATACCTCCTGCCAAGTCAAAGCTGCCAGGCTACACCTAC
AAACAGCTCATCCTAAACCTGGCNTANCANGATNTCTTGGGTGTCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104145586..104146030 437
NO GENE  


Sequence tag IST14817D7BBF1
Sequence
CAGGCAAAGAAGGGCCCTTCTCCTATTTTCTCACCGTGTCTCATGTATCCTAGGCTGACCTCAAGACTCACCCTCAGACT
CACTGTGGACTCCCATCCCCCTTATTTACATTATCCTTGGAGGGAGAGAAAAGGGAGAAGAAGCCCCTTTCCAAGGCCTG
GAAAGTGTTACACATCAGCGTCTTTTAATTCAGGAGCCTGTGTGACCACCTCCCCCACCCCACAGCCTTTCCGGCTGCAT
CTACTCATAACCCAATGTTTAGCATCCACTAAGACACTGTGTATTCAGCATGTCGTCTCTAGTCATCATTCAAAACAGTC
TCTCGTGTCACTCATTTATCTGAGCTGTTGTTGGTACTGTGATACCTCCTGCCNAGTCAAAGCTGCCAGGCTACACCTAC
AAACAGCTCATCCTAAACCTGGCATAGCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104145596..104146030 433
NO GENE  


Sequence tag IST14817D7HMR1
Sequence
GCCTGGGCTCTGAAGGAGGCTGGGAGGTGTCTCATCACTCAGTACCCGAATGCCTTTGGCCTTTCTGCTTTGTGTTCTGC
TTTGTACATANACCCANCTGCCCCTCCACCACCCCAGAAGCCCAGAATCTCACTGTTGCCCAAGGGACAGCCTTCATCTC
CACTGAATGCCCCAGCCACACTGCCACCTAGCAAGTACCATCCATGCTCANTGCTCCTTGCCCATTGATTCCTCAGGGCC
CTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI32535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104146026..104146271 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es