Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0480
Clone ID CC0480
Vector pGT0lxfT2
Project sanger

Sequence tag CC0480
Sequence
TAGATTCCGAGGAGTGAATTTGATGGAGATTTACAATCCCAACTTCTAAGTAAAGCTAATGAAGAAGATAAAAACTGTAG
CAGAGCACTCTCTGTGGTAAGCACTGTTGTTCGAGCTGCGAAGGACCTGTTGCACAGAGCTCTTGCTGTGGATGCTGATG
ACATTCCAGAACTGCTTAGCTCTTCCAGTCTGTTTTCCATGCTGCTTCCCCTTATTATAGCCTACATAGGACCAGTAGCC
GCTGCTATTCCCAAGGTTGCTGTAGAAGTTTTTGGCCTTGTCCAGCAATTGCTTCCCTCAGTTGCCATTTTGAATCAGAA
GTATGCACCCCCTGCGTTCAATCCCAATCAGTCAACTGATAGTACGACAGGCAACCAGCCCGAGCAAGGCCTCTCAGCTT
GTACCACTTCCAATCACTATGCTGTCATTGAGAGTGAGCACCCATACAAGCCTGCCTGTGTGATGCACTACAAG
Sequence Type mRNA
Unitrap ID UNI3058

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 103603539..103606000 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033004 (Mycbp2) NP_997098 MYC binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2179432]

 
Come back to gene ENSMUSG00000033004


For any suggestions or comments, please send an email to unitrap@crg.es