Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10674H11
Clone ID IST10674H11
Vector VICTR76
Project tigm

Sequence tag IST10674H11HMR1
Sequence
CCTAGACTTCTCCCTGGGTGACAGGTATGGATCCAGGGTGGCCTTTTATTAAAAGACTTANGACTTCATGACTCATTTTT
TCCCCCAGCTCCACTCCTCCANAGGTACCCAGTGGAGAAAAGAGGAATGGCGGTGGACCACGCCAAAAATAAGGTACACT
GGGGTTTCTGTTGGGATGACCCACAAATACTGTATTTTCTGGCTATAAAAAAGTGTGTTCTTGTTTTTCAATTATTTGGA
GCTGGTGACAACTGGCTAGTAGGACATGTAAATGTCACTTCCATGCCTCCCTTTAAAAGTAAGGCGACTTTCCCCAGCCT
GCTANTANAATAAGGAATGTGACTTTTTGCATAATAAAGANCANTTGGCAGGAATTAANGGGGTGGC
Sequence Type genomic DNA
Unitrap ID UNI15003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30695114..30695499 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058402 (Zfp420) zinc finger protein 420 Gene [Source:MGI (curated);Acc:Zfp420-001]

 
Come back to gene ENSMUSG00000058402


For any suggestions or comments, please send an email to unitrap@crg.es