Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14272F9
Clone ID IST14272F9
Vector VICTR74
Project tigm

Sequence tag IST14272F9HMR1
Sequence
CCCTAGACCCAGTCGCTTTACGACAAAACCTTTGCTTGCCTTTCCTTCACTGTCCGAGTGCTTTGGGGTTGTTTGTTTGT
TTGTTTTTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22426242..22426334 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST14272F9HMF1
Sequence
TAGGGCACGGCCCTGGCACCCACTTAGAGCATTCGTAGTGCATCAATGTGACCTGGGTTTCATCATCTAAGGTGGAGCTG
AGTGGCCTTCAGACTACTTTCCCTCAGCAACTATGCTCTGCATTTTCATACTCAACCTCTACCAGTATGAGAGACGACAG
AAAAAGAGGCCTAAGGAGCAGCCTGTTCTTCAGGCCCTGATGTGGCTGCGTCAGANTCTGTGCAGAGAGTGTGGCTGCAC
TGACCACAGCAAGCCTGCCTCACTTTCGCCCCAGCAGGGTCAAGGCATCGAGTCGGANGCTCAAAGGGGACCTTTAGCTT
GAAACTTAAGCTTAACTGTCTCAATCATTTTCTCTCANTTTATATAGTTCTTACCTAAATTGACATAAAGTGAAGTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22426330..22426728 393
 
EST/CDNA Est Name
  CD542094.1 - BY322994.1 - CD545468.1 - CN687119.1 - CN686830.1 - CN684524.1 - CN683331.1 - BB620884.1 - CN678818.1 - CA874797.1 - BG963178.1 - CN680213.1 - CN670507.1 - BG864014.1 - BQ896986.1 - BY244967.1 - CN677663.1 - CN686593.1 - CA873927.1 - CA875969

 
Come back to gene CD542094.1 - BY322994.1 - CD545468.1 - CN687119.1 - CN686830.1 - CN684524.1 - CN683331.1 - BB620884.1 - CN678818.1 - CA874797.1 - BG963178.1 - CN680213.1 - CN670507.1 - BG864014.1 - BQ896986.1 - BY244967.1 - CN677663.1 - CN686593.1 - CA873927.1 - CA875969


For any suggestions or comments, please send an email to unitrap@crg.es