Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14253E1
Clone ID IST14253E1
Vector VICTR74
Project tigm

Sequence tag IST14253E1HMR1
Sequence
ATGTGAGTACACTGTANCTGTCNTNANACACACCTGAAGAGAGCATCAGATCCCATTACAGATGGGTGTGAGCCACCATG
TGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAGAACAGTGCTCTTAATTGCTGAGCCGTCTTTCCATCCCGAC
Sequence Type genomic DNA
Unitrap ID UNI8225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107718782..107718935 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]


Sequence tag IST14253E1HMF2
Sequence
CATACATAAAAATAAATAAATAATTTTTTTAAAATGTGTATTCTTCATTCATATATGCCATCATATCTCATCAGAGAAGA
AAGCATACAGGTACACTCACCTGCACGGGGAGAGCACTGCCTACACTGGGTTGGGCTGCTACATCAATGTATACTAAGCA
AGAAAATTCCCCACAGACATGGCAATAAGGCCATATGAGGGGGACAATACTTCCCGGGTGAGCCTAGTTTGTGTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107718933..107719168 236
 
EST/CDNA Est Name
  BY125091.1 - BY074985.1 - CJ161996.1 - BY074704.1 - BY778448.1 - BY145772.1 - BY793386.1 - BY322492.1


Sequence tag IST14253E1BBF1
Sequence
TAGTNNCTGTGCTGTATGCCACCTCTCCTATAAGAATCTCACTGCTGTCCCCATTTTATAGACGANAAGATGGAGGCTCA
GGGCAGACTCTGTTTAAGGTTACTGAGTCTAGGAGCCAAATCAGAATGTAGGTAGATGTAAGTGATTTTGCTGCTCACTA
CAATCCCACACCAGCACTGCAGGGGCCTGTGTCAAGGCCTCGGCCATACTGCAGTGTCTANTCATTTACACATGTCTCCG
TTCACTAAGGCTACAAGACCAGGCTATTCANTTCTGTTTCACTGGCCCTANAACAGTTTTGGTGTTTAATCCNCTATGCA
AATGTNNGNNGAATGAACTNNNNNACCGATNNCTGGANGAATGATTGCNNNGGANGTTTCCTNACNNNNNNTATGGCCTN
NNANACTGTGTCTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BY125091.1 - BY074985.1 - CJ161996.1 - BY074704.1 - BY778448.1 - BY145772.1 - BY793386.1 - BY322492.1


For any suggestions or comments, please send an email to unitrap@crg.es